rs1424659 chr2:170229317 T>C
- Sequence
ggctcaaggtcagccaaggattaa[T/C]agctttaggtctgtttgccttgcc
- ASB in cell types
- K562 (myelogenous leukemia) D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | -0.20 | 2.07 | 1.50 | 1.98 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease, autism, cystatin c in serum, hip bone mineral density (bmd), irritible bowel syndrome, ldl cholesterol change with statins, rheumatoid arthritis, stabilized warfarin dose, total cholesterol change with statins