rs1425084 chr7:131859468 A>G
- Sequence
ttcacagtgttcagctgcttgagc[A/G]tggcttccatccattcggggagag
- ASB in cell types
- GBM39 (Human brain tumor) foreskin keratinocyte MCF10AT1 (breast premetastatic epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.77 | 0.51 | 1.37 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), obesity with early age of onset (age >2), years of education