rs1427222 chr10:58531210 A>G
- Sequence
ctgatgaggaataggcatactttg[A/G]ttgcctggggactgctgagaacaa
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) MOLM-13(acute monocytic leukemia(AML), Homo sapiens) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RH4 (alveolar rhabdomyosarcoma) | -0.34 | 1.76 | 1.11 | |||
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | 2.12 | -0.57 | 1.75 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.31 | 0.84 | 1.09 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Putamen_basal_ganglia, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid