rs1427223 chr10:58531206 T>C
- Sequence
agtgctgatgaggaataggcatac[T/C]ttgattgcctggggactgctgaga
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RH4 (alveolar rhabdomyosarcoma) | -0.15 | 1.83 | 1.11 | |||
| GM17942 (lymphoblastoid cell) | 1.80 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Putamen_basal_ganglia, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid