rs1427281 chr15:58667074 T>C
- Sequence
gttcaactaatgaataagccctca[T/C]tgagatgctaaatcataggatgca
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -0.44 | 1.41 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol, homa-ir, infant head circumference, sporadic creutzfeldt-jakob disease, stabilized warfarin dose
GTEx eQTL Artery_Tibial, Brain_Hippocampus, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid