rs1427959 chr5:174401952 C>T
- Sequence
aagatctgaaggagtagaaagagc[C/T]ggctagggaatctgtcttcacttt
- ASB for transcription factors
- ZN384_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN384_HUMAN | 2.47 | -2.18 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, age at death with kuru exposure, arthritis including non-rheumatoid, primary rhegmatogenous retinal detachment, rheumatoid arthritis, total cholesterol