rs1428729 chr5:20538154 A>G
- Sequence
tgtcccattctccaaaaatgcaga[A/G]cacatcactatgaatgtaagaaat
- ASB in cell types
- MDM(monocyte derived macrophages) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.31 | 0.13 | 1.88 | |||
| THP-1 (acute monocytic leukemia) | 0.10 | 1.25 | 1.50 |
Items per page:
1 – 2 of 2