rs1429248 chr2:154495698 C>T
- Sequence
gggacaggagaagaaacgatcaga[C/T]ggactttgaggcttcttcagttca
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.02 | 1.05 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, celiac disease, diabetic retinopathy in type 2 diabetes mellitus, infant head circumference, ldl cholesterol, premature ovarian failure, refractive error, rheumatoid arthritis, tetrology of fallot, total cholesterol, triglycerides