rs1430621 chr2:9990950 C>A
- Sequence
cagcgggaggggttttcctgggga[C/A]tacaggatagatccctgggttttc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) A-673 clone Asp114 (Ewing sarcoma)
- ASB for transcription factors
- TF65_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.83 | n/a | 3.00 | n/a | No Hit | |||
| FLI1_HUMAN | 1.94 | 0.11 | 1.40 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Lung, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid