rs1430779 chr2:67650976 T>C
- Sequence
gagccatcactcaccacagcccgc[T/C]ggaattctcatgctggagcaacag
- ASB in cell types
- HMEC (human mammary epithelial cells) HepG2 (hepatoblastoma) Peyer's patch
- ASB for transcription factors
- RAD21_HUMAN STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.85 | 0.19 | 1.30 | n/a | n/a | |||
| STAG2_HUMAN | 2.15 | -0.03 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism, diastolic blood pressure (dbp), hdl cholesterol change with statins, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (broad definition) (males)