rs1432295 chr2:60839531 G>A
- Sequence
ctctaattctaatctgaccgtggg[G/A]gacagtcgagagcagtgcttttca
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.95 | 0.25 | 1.17 | n/a | No Hit | |||
| STAG1_HUMAN | 1.01 | -0.99 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP classical hodgkins lymphoma, classical hodgkins lymphoma (epstein-barr virus subtype), crohns disease, ldl cholesterol change with statins, neuroblastoma (brain cancer), rheumatoid arthritis, total cholesterol change with statins
PheWAS abnormal glucose, abnormal thyroid function, acne, acquired toe deformities, acute laryngitis and tracheitis, alcohol-related disorders, allergic conjunctivitis, aneurysm and dissection of heart, antisocial/borderline personality disorder, balanoposthitis, behcets syndrome, benign neoplasm of skin, benign neoplasm of uterus, bipolar, bladder neck obstruction, carcinoma in situ of skin, carditis, cervical cancer and dysplasia, cervical intraepithelial neoplasia (cervical dysplasia), cholesteatoma, congenital anomalies of great vessels, congenital anomalies of limbs, congenital deformities of feet, conjunctivitis, noninfectious, dermatosis nos, diseases of nail, diseases of sebaceous glands, diseases of spleen, disorders of conjunctiva, disorders of esophageal motility, disorders of fluid, electrolyte, and acid-base balance, disorders of lacrimal system, disorders of parathyroid gland, disturbances of amino-acid transport, disturbances of sulphur-bearing amino-acid metabolism, dry eyes, electrolyte imbalance, erythematous conditions, essential tremor, functional digestive disorders, glaucoma, hallux valgus (bunion), hammer toe, heart valve replaced, hyperparathyroidism, impacted cerumen, impaired fasting glucose, infection of the eye, inflammation of the eye, intestinal obstruction without mention of hernia, irritable bowel syndrome, lack of coordination, light-headedness and vertigo, mixed hyperlipidemia, muscle/tendon sprain, noninfectious gastroenteritis, osteitis deformans and osteopathies associated with other disorders, osteoarthrosis of multiple sites, osteochondropathies, osteoporosis, osteoporosis, nos or other, other cells and casts in urine, other disorders of adrenal glands, other disorders of eyelids, other disorders of intestine, other disorders of stomach and duodenum, other disorders of the kidney and ureters, other disorders of tympanic membrane, other hypertrophic and atrophic conditions of skin, other pulmonary inflamation or edema, other specified diseases of hair and hair follicles, other specified diseases of nail, other specified diseases of sebaceous glands, other specified osteoporosis, otitis externa, paralytic strabismus, pathologic fracture, pericarditis, personality disorders, postmenopausal atrophic vaginitis, postmenopausal bleeding, psoriasis, psoriasis & related disorders, psoriasis vulgaris, respiratory insufficiency, retinoschisis and retinal cysts, rosacea, scar conditions and fibrosis of skin, sebaceous cyst, seborheic dermatitis, seborrheic keratosis, secondary malignancy of bone, skin cancer, sprains and strains, subarachnoid hemorrhage, symptoms involving cardiovascular system, type 1 diabetes nephropathy, unequal leg length (acquired), upper gastrointestinal congenital anomalies, urethral stricture (not specified as infectious), vascular disorders of penis, vertiginous syndromes and other disorders of vestibular system
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Spleen, Whole_Blood