rs1432534 chr2:182192719 A>C
- Sequence
agtaagtagaaaaactagtcccat[A/C]gaaatggaaactcaaggcagcctg
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.01 | 1.39 | 1.11 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, fasting insulin, homa-b, homa-ir, ldl cholesterol change with statins, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio