rs1434282 chr1:199041592 C>T
- Sequence
catcaatgttcaagtcccaagaga[C/T]gttatcagtctgaacagcccagtg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 2.35 | -2.04 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI high light scatter reticulocyte percentage of red cells, mean corpuscular hemoglobin, mean corpuscular volume, mean platelet volume, red blood cell count, reticulocyte fraction of red cells