rs1434836 chr9:108060377 A>G
- Sequence
aggaatgctactaaacatcaatgc[A/G]tagaaaagtccccacaacaaagaa
- ASB in cell types
- GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 1.64 | -1.12 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, birth weight, hdl cholesterol change with statins, infant head circumference, obesity with early age of onset (age >2)