rs1435449 chr8:130881707 G>A
- Sequence
aattttccttaaaatgtacacctt[G/A]acatctctgaaatcagcatgcacc
- ASB in cell types
- PC9 (lung adenocarcinoma) A549 (lung carcinoma) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | -0.31 | 1.66 | 1.00 | |||
| A549 (lung carcinoma) | 0.92 | 0.63 | 1.01 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.83 | 0.89 | 1.00 |
Items per page:
1 – 3 of 3