rs1436204 chr10:50291675 C>T
- Sequence
agaggtatatttacaagtgctcta[C/T]aaagttagccacagggggatgcta
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) gastroesophageal sphincter adrenal gland esophagus squamous epithelium
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.06 | 1.81 | 1.21 | n/a | No Hit | |||
| STAG1_HUMAN | n/a | 1.36 | 2.17 | n/a | n/a |
Items per page:
1 – 2 of 2