rs1437466 chr2:65437216 C>T
- Sequence
cacatcccctctcccctctcatcc[C/T]ccactttaagatgagccctgagaa
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.10 | 1.74 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, aortic valve calcium, hip bone mineral density (bmd), primary rhegmatogenous retinal detachment, rheumatoid arthritis, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, total cholesterol, triglycerides