rs1437700 chr2:4123028 A>G
- Sequence
tagtaactgtttgctgattgtggt[A/G]tagatttataatgttgatttattc
- ASB in cell types
- primary prostate cancer
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary prostate cancer | 2.49 | 0.20 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, total cholesterol, variant creutzfeldt-jakob disease, years of education