rs1437751 chr15:96395916 G>A
- Sequence
ccagggggagccatagatgcatgg[G/A]caaggagcacgtgcggctgtgagg
- ASB in cell types
- T47D (invasive ductal carcinoma) EA.hy 926 (human umbilical vein endothelial cell line)
- ASB for transcription factors
- HIF1A_HUMAN HIF3A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | 2.15 | -0.80 | 1.75 | 0.33 | Weak Discordant | |||
| HIF3A_HUMAN | 2.10 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
