rs1438632 chr3:115815050 G>A
- Sequence
aagctcaggctggagcaaattaga[G/A]gaggggaaatacggtagtcccccc
- ASB in cell types
- foreskin keratinocyte Jurkat (T-cells) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.86 | n/a | 2.67 | |||
| Jurkat (T-cells) | 1.85 | -0.67 | 1.00 | |||
| Kelly (neuroblastoma) | -0.25 | 1.28 | 1.33 |
Items per page:
1 – 3 of 3