rs1439924 chr2:223459619 T>C
- Sequence
tctcctaatttcagtattaaaata[T/C]ataatttttgcctgggataaatgt
- ASB in cell types
- neural progenitors GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | 2.05 | -1.70 | 1.00 | |||
| GBM39 (Human brain tumor) | 0.01 | 1.46 | 1.00 |
Items per page:
1 – 2 of 2