rs1440980 chr11:76784032 C>T
- Sequence
gggggcgcagacagccctccccct[C/T]cccctcctgaggtcccaggacagc
- ASB in cell types
- breast tumor HepG2 (hepatoblastoma)
- ASB for transcription factors
- BRD4_HUMAN RBM25_HUMAN NFYC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.45 | 0.24 | 1.00 | n/a | n/a | |||
| RBM25_HUMAN | 2.75 | 0.57 | 2.00 | n/a | n/a | |||
| NFYC_HUMAN | -1.76 | 2.16 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid