rs1441762 chr8:20007176 G>A
- Sequence
gttccaaggatcttgacttgccgc[G/A]ttgtttttttctgaatttattaga
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.15 | -1.31 | 2.00 | -0.28 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, coronary artery disease (cad), fasting insulin, hdl cholesterol, hdl cholesterol (median hdl cholesterol), hdl cholesterol (modeled hdl cholesterol), hdl cholesterol change with statins, height, obesity with early age of onset (age >2), total cholesterol, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood