rs1442553 chr10:60704715 A>C
- Sequence
gatgcatcagactgttaatgttct[A/C]ctcagatttcaaattcattttaat
- ASB in cell types
- iPS-derived chondrocytes HepG2 (hepatoblastoma)
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.56 | -0.09 | 1.07 | -0.86 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP alzheimers disease, autism without verbal ability, diastolic blood pressure (dbp), ldl cholesterol, obesity with early age of onset (age >2), serum creatinine, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid