rs1443421 chr17:7133458 C>T
- Sequence
tccaactcctgagctcaggcaatc[C/T]gcccgccttggcctcccaaagtgc
- ASB in cell types
- GM17942 (lymphoblastoid cell) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | -3.44 | 3.60 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.89 | -0.16 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood