rs1443820 chr15:35506502 G>T
- Sequence
ctacattacctgagtttactcttc[G/T]gcatgggacagtgtaaataagagg
- ASB in cell types
- MCF7 WS8 cells MCF7 (Invasive ductal breast carcinoma) CFPAC-1(pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 1.86 | -0.22 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1