rs1444221 chr12:40375260 A>T
- Sequence
tggtaccataagattataatgaag[A/T]tgaaaaattcctgccccctagtga
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM19193 (female B-cells Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.34 | 1.02 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1