rs1444583 chr12:106919068 G>C
- Sequence
caaaaacttcattgaatatgcaaa[G/C]atcctacagcccctaagtgctttc
- ASB in cell types
- foreskin keratinocyte MCF10AT1 (breast premetastatic epithelial cells) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.93 | 2.45 | 2.67 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | -2.45 | 2.39 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.55 | 1.17 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, adiponectin levels, fasting insulin, height, homa-ir, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid