rs1445499 chr11:85826145 G>C
- Sequence
gggaacgtcttagaaatgcaggct[G/C]tctggccccaccccagacctataa
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.56 | 1.85 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), rheumatoid arthritis, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Ovary, Pituitary, Prostate, Stomach, Testis, Thyroid, Vagina