rs1445541 chr2:192886790 T>C
- Sequence
tcagattgacagagcaattgcttt[T/C]gtaaacattgacaccagggcacag
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 3.33 | -3.07 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, total cholesterol, years of education