rs1446883 chr7:64619186 G>A
- Sequence
aatgtgcaggaatttttacaattc[G/A]ggggaacagttctgttaggaaaga
- ASB in cell types
- liver adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 2.76 | -2.50 | 1.00 | |||
| adrenal gland | 1.14 | -0.69 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Frontal_Cortex_BA9, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid