rs1447779 chr3:174640206 C>T
- Sequence
tgcagctcggctcccagactaatg[C/T]tcttagctcctgcccttaactgct
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 1.28 | -0.06 | 3.11 | 0.08 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
