rs1448811 chr4:110589475 G>C
- Sequence
aattactcagtacaggagtgccag[G/C]aaatgaaataatattgtgacttca
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.91 | 2.18 | 2.00 | |||
| foreskin keratinocyte | 0.85 | -2.77 | 2.33 |
Items per page:
1 – 2 of 2