rs1450414 chr15:36888028 G>A
- Sequence
ctgttttatttaagccaatgggaa[G/A]gtattgagggcagtaattgattca
- ASB in cell types
- neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | -0.66 | 1.77 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hip bone mineral density (bmd), hypertension (early onset hypertension), late onset alzheimers disease, resistance to kuru in aged women despite likely exposure, years of education