rs1450985 chr3:64074452 G>A
- Sequence
cttaagacatgaaacatgccacac[G/A]agactatatcagtggctataaatt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.48 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), obesity with early age of onset (age >2), total brain volume (excluding patients with neuropsychiatric disorders), variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood