rs1451377 chr7:25893513 T>G
- Sequence
cctattaatttaaccagcaaatat[T/G]tattgaagcccctaatgtgccagt
- ASB for transcription factors
- PRD10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | 1.59 | -1.59 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, breast size (bra cup size in women), college completion, diastolic blood pressure (dbp), systolic blood pressure (sbp), triglycerides, years of education