rs1452686 chr4:108881273 G>T
- Sequence
tctgctgtctgtatttaggcactt[G/T]gctcatttcctgagagctgtggaa
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | 1.82 | -0.86 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1