rs1453950 chr15:36577226 G>A
- Sequence
aaggaaagagtaaagttgggaagg[G/A]gaaaggaatgaggatcaagtggtg
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SSXT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SSXT_HUMAN | 2.51 | -2.35 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, hypertension (early onset hypertension), premature ovarian failure, resistance to kuru in aged women despite likely exposure
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Nerve_Tibial, Thyroid, Whole_Blood