rs1454421 chr2:55420186 G>C
- Sequence
cggttgcgcccaggacggttgcct[G/C]gtgggcggggacagggaaggcaga
- ASB in cell types
- Kelly (neuroblastoma) OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- MYCN_HUMAN FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYCN_HUMAN | -0.49 | 2.19 | 1.67 | 6.19 | Concordant | |||
| FOXP1_HUMAN | 2.22 | 0.41 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood