rs1455878 chr2:184301689 A>C
- Sequence
tatgtgtgacatattggttctgag[A/C]aaaggtgacaccttataccatcac
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 1.68 | 0.23 | 1.12 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), systolic blood pressure (sbp)