rs1456389 chr4:153792964 A>T
- Sequence
aaatatttcaagggtctgggcccc[A/T]gatgggtgctcggaaagcaaacga
- ASB in cell types
- GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23338 | 2.19 | -0.14 | 1.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol, ldl cholesterol change with statins
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis