rs1457063 chr3:137843981 G>A
- Sequence
tttgtttgttttcttttgttttgg[G/A]tgatgaaagcttaaacatactcac
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.13 | -0.11 | 1.35 | n/a | No Hit | |||
| ANDR_HUMAN | 1.31 | -0.33 | 1.40 | 0.24 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, infant head circumference, ldl cholesterol change with statins, total cholesterol change with statins