rs1457211 chr8:108249089 A>G
- Sequence
gaggcccctgctttccaggaagtt[A/G]catacagggaagaatatctaggct
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.66 | 0.23 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.77 | 0.56 | 1.11 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, fasting blood glucose, homa-b, major depressive disorder, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg