rs1458836 chr11:75813751 C>T
- Sequence
taggagtaaaaaaaggaagatcaa[C/T]atcctgcagaatgactcatgctat
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- JUND_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | 2.94 | -2.61 | 1.00 | n/a | No Hit | |||
| JUN_HUMAN | 2.76 | -2.50 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, hdl cholesterol, partial epilepsy, refractive error, serum creatinine, simpson-angus scale, sporadic creutzfeldt-jakob disease, total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood