rs1459022 chr12:69901366 C>T
- Sequence
ataagttcacagatcttatgagaa[C/T]atttcctgttactgatgaggaatt
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, cystatin c in serum, hdl cholesterol, ldl cholesterol, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), recurrent early onset major depressive disorder (males), serum creatinine, total cholesterol change with statins, years of education