rs1459538 chr4:117771815 C>A
- Sequence
agatggccagagtcttccagcgat[C/A]gctccccctgcaggagaagcaaac
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) bipolar neuron IPSC-derived bipolar neuron neural progenitors
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.56 | 3.57 | 1.43 | 2.05 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
