rs1460239 chr8:104799137 C>T
- Sequence
cttacccacgttgcacatacagta[C/T]attaagggatcacattttgctgtc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.10 | 0.88 | 1.18 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP metacholine concentration in bronchial challenge test (pc20), obesity with early age of onset (age >2), systolic blood pressure (sbp), triglycerides