rs146744125 chr17:9402875 G>T
- Sequence
tcttcttcctgctaatgccaggct[G/T]tatcagtgactatggatacggaga
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -1.34 | 1.69 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1