rs146818838 chr10:110871802 T>G
- Sequence
acgtttcactcctctcccttttcc[T/G]cctcagctccggctccgccgccac
- ASB in cell types
- HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | -0.17 | 2.02 | 2.67 |
Items per page:
1 – 1 of 1