rs147003567 chr17:1487810 G>A
- Sequence
gtgggcgcctgtgtaatcccagct[G/A]ctcgggaggctgaggcacgagaat
- ASB in cell types
- HCT-116 (colon carcinoma)
- ASB for transcription factors
- MBD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MBD4_HUMAN | 1.81 | 0.86 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid, Whole_Blood